دوره 2، شماره 4 - ( 10-1401 )                   جلد 2 شماره 4 صفحات 61-54 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Zangeneh M, Sajadian M, Rigi A, Bahman dehkordi M, Hanani Ahvaz H, Abbasi birgani I. The study of the amount of Salmonella typhimurium in raw milk and local sheep cheese prepared in Farsan city of Chaharmahal and Bakhtiari provinces by PCR method. Zoonosis 2022; 2 (4) :54-61
URL: http://zoonosis.ir/article-1-68-fa.html
زنگنه مجتبی، سجادیان مائده، ریگی عبدالجلیل، بهمن دهکردی مهدی، حنانی اهواز هلن، عباسی بیرگانی عیسی. بررسی میزان شیوع سالمونلا تایفی‌موریوم در شیرخام و پنیر محلی گوسفندی عرضه شده در شهرستان فارسان از توابع استان چهارمحال و بختیاری به روش PCR. مجله بيماری های قابل انتقال بين انسان و حيوان. 1401; 2 (4) :54-61

URL: http://zoonosis.ir/article-1-68-fa.html


دانشگاه آزاد واحد شهرکرد ، Zangeneh_mjtaba@yahoo.com
متن کامل [PDF 915 kb]   (73 دریافت)     |   چکیده (HTML)  (373 مشاهده)
متن کامل:   (111 مشاهده)
مقدمه
سالمونلوزیس یکی از بیماری‌های عمده ناشی از مواد غذایی است که همواره منجر به نگرانی‌هایی در سطح بهداشت عمومی می‌شود (1). این باکتری با بیش از 2500 سروتیپ، جزء اولین یا دومین عوامل بیماری‌های ناشی از مصرف مواد غذایی آلوده در جهان می‌باشد (2). از بین سرووارهای مختلف سالمونلا، سرووارهای اینتریتیدیس وتایفی موریوم در مقام اول عفونت قرار دارند و دارای شیوع گسترده‌ای در آسیا (کره، ژاپن و تایلند و...) می‌باشند (3). اولین گزارش مربوط به شیوع مسمومیت غذایی ناشی از سالمونلا، توسط گارتنر در سال 1888 در آلمان بود (4). در مطالعاتی، شیوع آن 1/74 درصد در آمریکا و 6/6 درصد در ایران گزارش شده است (1 و 5). ناگان و همکاران در 2010 گزارش کردند که این باکتری تقریباً عامل 25 میلیون عفونت و حدود 200000 مرگ در سطح جهان می‌باشد. با توجه به میزان عفونت‌های گزارش شده و مرگ‌و‌میر بالای حاصل از این پاتوژن، پژوهش‌های فراوانی در خصوص وضعیت آلودگی مواد غذایی مختلف انجام پذیرفته است (6). مطالعات مختلف دلالت بر وجود گسترده باکتری سالمونلا در غذای انسان و خوراک دام دارد. تمامی سرووارهای سالمونلا برای انسان پاتوژن محسوب می‌شوند و بیشترین آلودگی در انسان به دلیل مصرف مواد غذایی پروتئینی است. غذاهایی از قبیل تخم‌مرغ، گوشت و فرآورده‌های گوشتی مانند سوسیس، کالباس، ماکیان و شیر خام و فرآورده‌های آن مانند پنیر، خامه و بستنی از متداول‌ترین منابع آلودگی انسان با سالمونلا می‌باشند (7). تاکنون همه‌گیری‌های مختلفی از سالمونلوز به ثبت رسیده است از آن جمله گزارش‌های شیوع ناگهانی سالمونلوز در ارتباط با مصرف انواع پنیر می‌باشد. بزانسون و همکاران در سال ۱۹۸۴ نشان دادند که علت شیوع سالمونلوز که در چهار ایالت کانادا اتفاق افتاده بود، مصرف پنیر چدار بوده است (8). بزرگ‌ترین شیوع سالمونلوز با عامل غذایی در ایالات متحده آمریکا رخ داده که ۱۶۲۸۴ نفر را مبتلا ساخت. یک مورد شیوع سالمونلوز در آمریکا از طریق بستنی آلوده به گزارش شده است که علت آن حمل بستنی با کامیونی بود که تخم‌مرغ آلوده حمل نموده بود (9).
با توجه به این که سالمونلا به عنوان یک ارگانیسم مقاوم در مواد غذایی مطرح می‌باشد، آزمایشات میکروبیولوژی مواد غذایی برای حضور این پاتوژن الزامی است (10). در حال حاضر، در آزمایشگاه‌های تشخیصی برای جستجوی بسیاری از میکروارگانیسم‌ها از روش‌های کشت میکروبی استفاده می‌شود. این روش در تشخیص آلودگی مواد غذایی به سالمونلا علاوه بر مشکلات انجام آزمایش و عدم دقت در پاسخ‌های حاصله، نیازمند مدت زمان زیادی جهت حصول به نتیجه نهایی است. در روش کشت میکروبی برای تشخیص آلودگی میکروبی مواد غذایی به سالمونلا تایفی موریوم چهار الی شش روز وقت لازم است که در مورد مواد غذایی از جمله شیر به عنوان یک ماده غذایی سریع الفساد، کارآمد نیست لذا به منظور افزایش حساسیت و کاهش زمان انجام آزمون از روش‌های دیگری مانند جستجوی ژن‌های  مربوط به این میکروارگانیسم‌ها از طریق روش PCR به عنوان روش جایگزین استفاده می‌شود (11). با توجه به اهمیت آلودگی سالمونلا در مواد غذایی در بین مصرف کنندگان خصوصاً افراد مسن وکودکان، هدف از این مطالعه تعیین میزان شیوع سرووار سالمونلا تایفی موریوم در شیرخام و پنیر گوسفندی عرضه شده در شهرستان فارسان استان چهارمحال و بختیاری با استفاده از روش PCR انجام شد.
مواد و روش­ها
نمونه‌گیری
در این مطالعه مجموعاً 20 نمونه شیر خام و پنیر گوسفند از دامداری‌های استان چهارمحال و بختیاری از مهر‌ماه تا اسفند‌ماه 1400 جمع‌آوری (هر نمونه مربوط به یک رأس دام بوده است) و در مجاورت یخ و در شرایط استریل به آزمایشگاه میکربیولوژی دانشگاه آزاد اسلامی واحد شهرکرد منتقل گردید و حداکثر شش ساعت پس از نمونه‌گیری از نظر حضور گونه‌های سالمونلا مورد آزمایش قرار گرفتند.
انجام آزمون‌های میکروبیولوژی
برای این منظور 25 میلی‌لیتر از نمونه شیر به 225 میلی‌لیتر از محیط کشت Buffered Peptone Water (Merck) انتقال داده و در دمای 37 درجه سلسیوس به مدت 24 ساعت گرم‌خانه‌گذاری گردید. سپس 10 میلی‌لیتر از این سوسپانسیون به محیط Selenit Cystine Broth  (Merck) به عنوان محیط کشت غنی‌کننده منتقل گردید و به مدت 24 ساعت گرم‌خانه‌گذاری گردید. سپس یک لوپ از محیط غنی‌کننده در محیط (Merck) Agar Salmonella Shigella  کشت داده شد و 24 ساعت در دمای 37 درجه گرم‌خانه‌گذاری شد. پرگنه‌های شفاف و بی‌رنگ گاه با مرکز سیاه، رشد کرده در این محیط از نظر تخمیر قند لاکتوز، تولید اندول، MR، VP، سیترات و اوره آز مورد بررسی قرار گرفتند (6).
تشخیص مولکولی سالمونلا تایفی موریوم
به منظور تشخیص سرووار سالمونلا تایفی موریوم، DNA جدایه‌ها با استفاده از کیت استخراج DNA ساخت شرکت سیناژن و طبق دستورالعمل کارخانه استخراج گردید. DNA استخراج شده تا زمان انجام بررسی‌های مولکولی در فریزر در 20- درجه سلسیوس نگهداری شد. جهت تشخیص سالمونلا تایفی موریوم از پرایمرهای اختصاصی ژن ST استفاده گردید (12). این جفت پرایمر قطعه‌ای حدود 100-150 جفت بازی از ژن مربوط به منطقه ژنومی کدکننده پروتئین اتصالی آدنوزین-3 'تری فسفات ترشحی نوع دوم را شناسایی و تکثیر می نماید که توالی آنها به صورت ذیل می باشد:

توالی پرایمر

پرایمر

5’ GCCAACCATTGCTAAATTGGCGCA 3’

ST11 F
5’ GGTAGAAATTCCCAGCGGGTACTGG 3’ ST15 R
   واکنش PCR در حجم نهایی 25 میکرو لیتر که شامل دو میکرولیتر از DNA استخراج شده، پنج  میکرولیتر PCR buffer 10x،یک میکرولیتر dNTP، دو میکرولیتر Mgcl2، دو میکرولیتر پرایمرهای F و R، 3/0 میکرولیتر آنزیم Taq DNA Polymerase و 7/12 میکرولیتر آب مقطر، با برنامه حرارتی 94 درجه به مدت یک دقیقه، 35 سیکل تکراری 94 درجه 60 ثانیه، 56 درجه 30 ثانیه و 72 درجه یک دقیقه و در نهایت 72 درجه 10 دقیقه انجام شد. مشاهده باند 429 جفت بازی نشان‌دهنده مثبت بودن آزمون PCR می‌باشد (12). جهت ردیابی محصول مورد نظر، 20 میکرولیتر از محصول PCR روی ژل 5/1 درصد آگارز واجد اتیدیوم برماید در ولتاژ ثابت 80 ولت الکتروفورز و ژل حاصله با دستگاه تصویر بردار ژل (Uvitech U.K) قرائت گردید. مشاهده باند 429 جفت بازی نشان‌دهنده وجود ژن ST  می‌باشد. از سالمونلا تایفی‌موریوم و آب مقطر دیونیزه بترتیب به عنوان کنترل مثبت و منفی در این بررسی مورد استفاده قرار گرفت.
نتـایج
نتایج حاصل از این تحقیق در جدول 1 نشان داده شده است.
جدول 1. تعداد و درصد موارد آلودگی به سالمونلا تایفی موریوم در نمونه‌های شیر خام و پنیر گوسفندی شهرستان فارسان
نمونه تعداد نمونه تعداد و درصد آلودگی با روش کشت تعداد و درصد آلودگی با PCR
شیر گوسفندی 20 (5/ 7 درصد) 3 (5 درصد)1
پنیر گوسفندی 20 (10درصد) 4 (10درصد)2
مجموع 40 (5/17درصد) 7 (15درصد)3
بحث
باکتری سالمونلا یکی از معمول‌ترین پاتوژن‌های منتقله از راه مواد غذایی است که در سرتاسر جهان در انسان و حیوان ایجاد بیماری می‌کند. محصولات گوشتی آلوده، منبع اصلی سالمونلا معرفی شده‌اند و به گزارش سازمان بهداشت جهانی، سالیانه بالغ بر 16 تا 33 میلیون مورد بیمار و 500 تا  600  هزار مرگ ناشی از سالمونلا اتفاق می‌افتد که این مسئله به عنوان یک معضل بزرگ بهداشتی در کشورهای در حال توسعه از جمله کشور ما مطرح می‌باشد. مهم‌ترین سروتیپ جدا شده از انسان سالمونلا تایفی موریوم و سالمونلا انتریتیدیس است، بنابراین، کنترل میکروبی مواد غذایی اهمیت خاصی دارد (13). عوامل میکروبی مختلفی می‌توانند موجب فساد مواد غذایی و بروز بیماری شوند. این باکتری سبب ایجاد بیماری‌های دستگاه گوارشی می‌شود و اصلی‌ترین راه انتقال آن به وسیله آب، گوشت، تخم مرغ و غذاهای خام می‌باشد (14). سالمونلوز از بیماری‌های عفونی مشترک بین انسان و دام می‌باشد و افزایش شیوع آن بین انسان و حیوان، مخصوصاً در دهه‌های اخیر، اهمیت بیماری را دو چندان می‌نماید. برای جلوگیری از آلودگی سالمونلا، برنامه‌های نظارتی مورد نیاز است.
نتایج حاصل از این تحقیق نشان داد که شیوع آلودگی به سالمونلا در نمونه‌های شیر خام و پنیر گوسفندی شهرستان فارسان 63/3 درصد می‌باشد. یکی از یافته‌های مهم مورد بررسی، آلودگی 63/1 درصد درصدی سالمونلا تایفی موریوم در نمونه‌های شیر می‌باشد. از سال 1970 آلودگی به سالمونلا در گوشت گاو در ایران مورد توجه محققان قرار گرفت. که، فراوانی آلودگی با سالمونلا در گوشت گاو حدود 6/2 درصد بود. در آن سال مرکز کنترل بیماری‌ها باکتری سالمونلاتایفی موریوم را به عنوان یکی از عوامل بیماری‌های ناشی از مصرف مواد غذایی آلوده در گوشت گاو گزارش کرد (14).
در تحقیق انجام شده توسط کارنز و همکاران که به منظور جستجوی سالمونلا انتروکولیتیکا بر روی نمونه‌های شیر خام صورت گرفت، از 854 نمونه مورد بررسی در 101 نمونه (8/11 درصد) به روش Real time PCR به این باکتری آلوده تشخیص داده شد (15). مطالعات سایر محققان درصدهای متفاوتی از فراوانی این باکتری را در نمونه‌های شیر نشان می‌دهد. به عنوان مثال، استیل و همکاران در 1997 آلودگی به سالمونلا را در نمونه‌های شیر 17/0 درصد گزارش کردند (16). موریندا و همکاران در 2002 شیوع گونه‌های سالمونلا را در شیر 24/2 درصد گزارش کردند (17). این نتایج با نتیجه به دست آمده از مطالعه حاضر هم‌خوانی نسبی را نشان می‌دهد. جایارو و هنینگ در 2001 شیوع سالمونلا را در نمونه‌های شیر 1/6 درصد گزارش کردند (18). روربچ و همکاران در 1992 شیوع سالمونلا در شیر را 9/8 درصد گزارش کردند (19). اختلاف در نتایج  ارائه شده می‌تواند به دلیل نوع روش جداسازی باشد. به علت حضور گونه سالمونلا در فضولات دامی، صنایع دامداری که گوشت و یا شیر تولید می‌کنند یک عامل تداوم حضور این پاتوژن انسانی در زنجیره غذایی می‌باشند. بنابراین می‌توان این گونه محصولات دامی را یک عامل بالقوه انتقال این بیماری در نظر گرفت (20).
 در تحقیق انجام شده توسط رستگار و همکاران در 1387، که به منظور آلودگی به سالمونلا بر روی نمونه‌های شیر پاستوریزه صورت گرفت، آلودگی به این باکتری در نمونه‌های شیر مشاهده نگردید (14). به این ترتیب با توجه به این که انتقال سالمونلا از طریق شیر و فرآورده‌های شیر امکان‌پذیر است، با پاستوریزاسیون شیر می‌توان احتمال انتقال را از بین برد. سالمونلا انتریکا سرووار تایفی موریوم و سالمونلا انتریکا سرووار انتریتیدیس از جمله سرووارهای بسیار مهم منتقله از راه مواد غذایی می‌باشند که در زمینه جداسازی این سرووارها تحقیقات متعددی صورت گرفته است. در بررسی انجام شده توسط جمشیدی و همکاران در مشهد آلودگی به سالمونلا تایفی موریوم در لاشه‌های مرغ 1/6 درصد گزارش گردید (5).
 در تحقیق انجام شده توسط ناگوا و همکاران در 2012 در یونان آلودگی به گونه‌های سالمونلا در جوجه‌های گوشتی 4/1 درصد، در گوشت مرغ فریز شده درصد و در افرادی که مسمومیت غذایی داشتند 10 درصد گزارش گردید. تفاوت در میزان آلودگی به سالمونلا در مطالعات انجام شده توسط محققین مختلف می‌تواند به علت تفاوت در روش نمونه‌گیری باشد (21).
در تحقیق انجام شده توسط فرامرزی و همکاران در سال 2012 که به منظور آلودگی باکتریایی مواد غذایی در سطح عرضه مناطق غرب تهران صورت گرفت، آلودگی سالمونلایی محصولات لبنی (254 نمونه)، محصولات پروتیئنی (173) نمونه، شیرینی‌جات و آب میوه‌ها به ترتیب 8/1 درصد، 85/0 درصد و صفر درصد گزارش گردید. میزان آلودگی بستنی‌های سنتی به سالمونلا در این بررسی 54/11 درصد و بستنی‌های صنعتی 7/2 درصدگزارش گردید. از نظر آلودگی سالمونلایی از مجموع 642 نمونه مورد بررسی، در چهار مورد (26/0 درصد) آلودگی سالمونلایی گزارش گردید (22). حال آن که در پژوهش انجام شده توسط سلطان دلال و همکاران در سال 2009، 8/47 درصد از نمونه‌های مرغ و 8/28 درصد از گوشت قرمز به سالمونلا آلوده بودند. در این بررسی سروتیپ غالب مربوط به S.thompson   (9/54 درصد) و  S.enteritidis (8/9 درصد) بوده است فدایی و همکاران در 2008 نشان دادند 70 درصد نمونه‌های شیر خام به اشرشیاکلی آلوده بودند (23).
نتیجه‌گیری کلـی و پیشنهادها
عدم رعایت زنجیره سرما در حمل و نقل شیر، عدم شستشو و ضدعفونی کردن مناسب پستان دام به علت آلوده بودن پستان گاوها با مدفوع خود گاو، عدم رعایت بهداشت فردی کارگران گاوداری‌ها و انتقال باکتری از دست آن‌ها به شیر، عدم استفاده از آب سالم بهداشتی جهت شستشوی ظروف حمل و نگه‌داری شیر، پایین بودن سطح آگاهی کارگران گاوداری‌ها در زمینه بهداشت و سلامت شیر و پایین بودن سطح بهداشت دام‌ها از عوامل اصلی آلودگی شیر می‌باشد. نتایج حاصل از تحقیق حاضر نشان می‌دهد که آلودگی نمونه‌های شیر خام و پنیر، گوسفندی به سالمونلا تایفی موریوم بعنوان یک میکروارگانیسم مشترک بین انسان و دام و شایع‌ترین عامل عفونت‌های سالمونلایی انسان می‌باشد و این امر ضرورت مراعات ضوابط بهداشتی بخصوص در مرحله شیردوشی و حمل و نقل و اجتناب از مصرف بطور مستقیم و یا در تولید فرآورده‌هایی مثل پنیر سنتی، بستنی سنتی و... واضح‌تر می‌سازد.
تقـدیر و تشـکر
از تمامی کسانی که در جمع‌آوری نمونه همکاری کردند سپاسگزاریم.
تعارض منافع
هیچ­گونه تضاد منافعی بین نویسندگان وجود ندارد و این مقاله با اطلاع و هماهنگی آنها ارسال شده است.
مرور کتاب: گزارش کوتاه | موضوع مقاله: بهداشت مواد غذایی
دریافت: 1401/11/28 | پذیرش: 1401/12/20 | انتشار: 1402/6/3

فهرست منابع
1. De Freitas CG, Santana AP, da Silva PH, Gonçalves VS, Barros Mde A, Torres FA, et al. PCR multiplex for detection of Salmonella Enteritidis, Typhi and Typhimurium and occurrence in poultry meat. International Journal of Food Microbiology. 2010; 139: 15-22. [DOI:10.1016/j.ijfoodmicro.2010.02.007] [PMID]
2. Foley SL, Lynne AM. Food animal-associated Salmonella challenges: pathogenicity and antimicrobial resistance. Journal of animal science. 2008; 86: 173-187. [DOI:10.2527/jas.2007-0447] [PMID]
3. Solhan S, Chan PP, Kurupatham L, Foong BHPL, James L, Phua L, Tan AL, Koh D, Goh KT. An outbreak of gastroenteritis caused by Salmonella enterica serotype enteritidis traced to cream cakes, West Pac Survey Research. 2011; 2: 23-30. [DOI:10.5365/wpsar.2010.1.1.001] [PMID] [PMCID]
4. Shapouri R, Rahnama M, Iqbalzadeh Sh. Investigating the prevalence of Salmonella serotypes in chicken meat and eggs and determining their antibiotic sensitivity in Zanjan city. The Quarterly Journal of Biological Sciences, Islamic Azad University, Zanjan Branch. 2009; 2(3): 71-63.
5. Jamshidi A, Bassami MR, Afshari-Nic S. Identification of Salmonella spp. and Salmonella typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad- Iran. International Journal of Veterinary Research. 2009; 3(1) 43-48.
6. Saroj SD, Shashidhar, R, Karani M, Bandekar JR. Rapid, sensitive, and validated method for detection of Salmonella in food by an enrichment broth culture- nested PCR combination assay. Molecular and Cellular Probes (MCP). 2008; 22: 201-206. [DOI:10.1016/j.mcp.2008.02.002] [PMID]
7. Espie E, Vaillant V. International outbreak of Salmonella Stourbridge infection, April- July 2005: results of epidemiological, food and veterinary investigations in France. Euro Surveillance. 2005; 10(8): E050811 3. [DOI:10.2807/esw.10.32.02772-en] [PMID]
8. Bezanson GS, Khakhria R, Duck D, Lior H. Molecular analysis confirms food source simultaneous involvement of two distinct of but related subgroups of Salmonella typhymurium bacteriophage type 10 in major interprovincial Salmonella outbreak. Applied and Environmental Microbiology. 1985; 50(5): 1279-1284. [DOI:10.1128/aem.50.5.1279-1284.1985] [PMID] [PMCID]
9. Hennessy TW, Hedberg CW, Slutsker L, Besser-Wiek JM, Moen ME, Feldman, J., et al. The Investigation Team. The New England Journal of Medicine. 1996; 334: 1281-1286. [DOI:10.1056/NEJM199605163342001] [PMID]
10. Fitts R, Diamond M, Hamilton C, Neri M. DNA-DNA hybridization assay for detection of Salmonella spp. In foods. Applied and Environmental Microbiology. 1983; 46: 1146- 51. [DOI:10.1128/aem.46.5.1146-1151.1983] [PMID] [PMCID]
11. Rijpens N, Herman L, Vereecken F, Jannes G, De Smedt J, De Zutter L. Rapid detection of stressed Salmonella spp.a In: Dairy and egg products using immunomagnetic separation and PCR. International Journal of Food Microbiology. 1999; 46: 37- 44. [DOI:10.1016/S0168-1605(98)00171-8] [PMID]
12. Soumet C, Ermel G, Rose V, Rose N, Drouin P., Salvat, G. and Colin, P. Identification by a multiplex PCR based assay of Salmonella Typhimurium and Salmonella enteritidis strains from environmental swabs of poultry houses. Letters in applied microbiology. 1999. 29(1): 1-6. [DOI:10.1046/j.1365-2672.1999.00559.x] [PMID]
13. Nosrati S, Sabokbar A, DezfoolIan M, Tabarraei B, Falah F. Prevalence of Salmonella enteritidis, typhi and typhimurium from food products in Mofid Hospital. Research in Medicine 2012; 36(1): 43-48. [DOI:10.1186/1471-2334-12-S1-P95] [PMCID]
14. Rastegar H, Ghahremani MH, Hallaj Neyshaburi Sh, Jalali M, Anjarani S, Khosrokhavar R. Evaluation, isolation and detection of Salmonella Typhimurium in milk by conventional culture and PCR methods. Iranian Journal of Nutritional Sciences and Food Industries. 2007; 3(3): 45-52.
15. Karns JS, Van Kessel JS, McCluskey BJ, Perdue ML. Prevalence of Salmonella enterica in Bulk Tank Milk from US Dairies as Determined by Polymerase Chain Reaction. Journal of Dairy Science. 2005; 88: 3475-3479. [DOI:10.3168/jds.S0022-0302(05)73031-9] [PMID]
16. Steele ML, McNab WB, Poppe C, Griffiths MW, Chen S, Degrandis SA, Fruhner LC, Larkin CA, Lunch JA,Odumeru JA. Survey of Ontario bulk tank milk for foodborne pathogens. Journal of Food Protection. 1997; 60: 1341-1346. [DOI:10.4315/0362-028X-60.11.1341] [PMID]
17. Murinda SE, Nguyen LT, Ivey SJ, Gillespie BE, Almeida RA, Draughon FA, et al. Molecular characterization of Salmonella spp. isolated from bulk tank milk and cull dairy cow fecal samples. Journal of food Protection. 2002; 65:1100-1105. [DOI:10.4315/0362-028X-65.7.1100] [PMID]
18. Jayarao BM, Henning DR. Prevalence of foodborne pathogens in bulk tank milk. Journal of Dairy Science. 2001; 84: 2157-2162. [DOI:10.3168/jds.S0022-0302(01)74661-9] [PMID]
19. Rohrbach BW, Draughon FA, Davidson PM, Oliver SP. Prevalence of Listeria monocytogenes, Campylobacter jejuni, Yersinia enterocolitica, and Salmonellain bulk tank milk: Risk factors and risk of human exposure. Journal of food Protection. 1992; 55: 93-97. [DOI:10.4315/0362-028X-55.2.93] [PMID]
20. Daoust JY. Salmonella and the international food trade. International Journal of food Microbiology. 1994 ;24(1-2): 11-31. [DOI:10.1016/0168-1605(94)90103-1] [PMID]
21. Fadaei A, Jamshidi E, Kheiri S. Comparison of bacterial contamination of raw and pasteurized milk used in Shahrekord in 2006. Journal of Shahrekord Uuniversity of Medical Sciences, 2008;10:(2). 37-44.
22. Faramarzi T, Jonidi Jafari A, Dehghani S, Mirzabeygi M, Naseh M, Rahbararaste H. Asurvey of Bacterial Contamination of Food Supply in the West of Tehran. Journal of Fasa University of Medical Science. 2012; 2(1): 11-18.
23. Fadaei A, Jamshidi E, Kheiri S. Comparison of Bacterial Contamination of Raw and Pasteurized Milk Used in Shahrekord in 2006. J Shahrekord Uuniv Med Sci. 2008;10(2): 37-44.

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب‌سایت متعلق به مجله بیماری های قابل انتقال بین انسان و حیوان است.

طراحی و برنامه نویسی: یکتاوب افزار شرق

© 2024 All Rights Reserved | Journal of Zoonosis

Designed & Developed by: Yektaweb