دوره 3، شماره 1 - ( 2-1402 )                   جلد 3 شماره 1 صفحات 56-43 | برگشت به فهرست نسخه ها

Ethics code: IR.IAU.SHK.REC.1402.006

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

shavandi A, shakerian A. Examining the contamination of lymph nodes of cattle and sheep carcasses in Qom province with Brucella by real-time PCR. Zoonosis 2023; 3 (1) :43-56
URL: http://zoonosis.ir/article-1-76-fa.html
شوندی احمد، شاکریان امیر. بررسی آلودگی عقده های لنفاوی لاشه های گاو وگوسفند استان قم به باکتری بروسلا با روش Real Time PCR. مجله بيماری های قابل انتقال بين انسان و حيوان. 1402; 3 (1) :43-56

URL: http://zoonosis.ir/article-1-76-fa.html


گروه بهداشت و کنترل کیفی مواد غذایی، دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران ، haram9463@gmail.com
واژه‌های کلیدی: Brucella، Brucella abortus، Brucella melitensis، Real time PCR
متن کامل [PDF 807 kb]   (72 دریافت)     |   چکیده (HTML)  (521 مشاهده)
متن کامل:   (82 مشاهده)
مقدمه
بروسلوز  یک بیماری مشترک بین ‌انسان ‌و‌ دام ‌می¬باشد که هم دام¬های اهلی و هم حیوانات وحشی را تهدید می¬کند و باعث سقط جنین و ناباروری در آن¬ها می¬شود. عوامل عفونی این بیماری باکتری¬هایی از جنس بروسلا  هستند که گرم منفی و هوازی اختیاری هستند و می¬توانند درون ماکروفاژها به¬صورت درون¬سلولی تکثیر کنند (1و2). گونه‌های بروسلا به طور کلاسیک به شش گونه اصلی طبقه بندی می شوند که دو گونه بروسلا ابرتوس   و ملیتنسیس  باعث سقط جنین در نشخوارکنندگان می‌شوند (3). در اکثر موارد بروسلوز در ایران، B. abortus و B. melitensis عوامل اصلی بیمار‌ی‌زا هستند (4). 
این باکتری به¬طور بالقوه¬ای برای انسان بیماری‌زا بوده و عامل ‌بروسلوز انسانی یا تب‌ مالت  می¬باشد. به رغم کنترل این بیماری در اغلب کشورها، بیماری در ایران به صورت اندمیک مشاهده می¬گردد (5). 
انتقال از طریق مواد غذایی راه مهم و اصلی آلودگی انسان¬ها در مناطق شهری است. مصرف شیر تازه یا محصولاتی که از شیر نجوشیده بدست می¬آیند به عنوان منبع اصلی آلودگی در نواحی شهری عمل می¬کند.
روش‌های تشخیصی مبتنی بر کشت با وجود آنکه استاندارد طلایی محسوب می¬شوند حساسیت پایینی تا 70 درصد دارند. علی¬رغم توسعه فراوان و دسترسی آسان تست¬های سرولوژیک، مشکل مهم این تست¬ها ایجاد نتایج مثبت کاذب به دلیل واکنش متقاطع با آنتی¬ژن¬های سایر میکروارگانیسم¬ها مانند یرسینیا انتروکولیتیکا، سالمونلا اورینتالیس، ویبرو کلرا، فرانسیسلا تورانسیس و اشریشیا کلی می¬باشد) 6).
 کاربرد روش¬های نوین تشخیصی از جمله PCR و مشتقات آن که ساده، سریع و حساس بوده و نیز اختصاصیت بیشتری نسبت به تست¬های سرولوژیکی دارد، بر مبنای تشخیص اسید نوکلئیک توسعه یافته‌اند (7و8). بنابراین استفاده از روش‌های مولکولی به عنوان تست¬های تاییدی جهت رفع مشکلات مربوط به آزمون¬های سرولوژیکی مانند نبود الگوهای مناسب جهت تفسیر تیترهای آنتی¬بادی در مناطق اندمیک، ضرورت یافته¬ است. گزارشاتی وجود دارد که نشان می¬دهند که تشخیص DNA بروسلا توسط PCR حساس¬تر از کشت خون و اختصاصی¬تر از آزمون سرولوژیکی برای تشخیص بیماری حاد می¬باشد (9و10).
یکی از مشتقات PCR تکنیک Real- time PCR می¬باشد که علاوه بر شناسایی، با حذف بسیاری از فرایندهای وقت¬گیر، امکان بررسی میزان محصول را در حین انجام واکنش در نمونه‌ها میسر ساخته است. 
در این مطالعه به منظور تشخیص سریع و دقیق‌تر بیماری بروسلوز به بررسی ژنومی B. abortus و B. melitensis در عقده‌های لنفاوی لاشه¬های کشتارشده به روش Real time PCR می¬پردازیم.
مواد و روش¬ها
جمع آوری نمونه¬ها
تعداد 95 نمونه از عقده‌های لنفاوی دام¬های کشتارشده (گاو، گوسفند و بز) به طور تصادفی از کشتارگاه های شهرستان قم جمع آوری گردید. جمع آوری نمونه¬ها در فصول تابستان و پاییز سال 1401 انجام پذیرفت. در مجموع از 95 نمونه اخذ شده، تعدادی از نمونه¬های اخذ شده به علت محدودیت¬های آزمایشگاهی حذف شد. نهایتا از کل 44 نمونه باقی مانده (شامل 30 نمونه از گوسفند و بز و 14 نمونه از گاو) آزمون انجام شد. 17 نمونه از دام ها تست رزبنگال مثبت و مابقی نمونه¬ها تست رزبنگال منفی داشتند. نتایج حاصله در جدول های یک تا چهار به صورت خلاصه آمده است.
جدول 1. مشخصات نمونه¬ها
        سابقه سقط جنین    نوع نمونه    استان
مبداء    نژاد دام    سن دام
(ماه)    جنس دام    نوع دام    شماره نمونه
نتیجه تست Real timer pcr    نتیجه تست رزبنگال        پیش کتفی    پستان    کبد                        
منفی    منفی    دارد    *    *    *    مرکزی    بومی    36    ماده    گوسفند    1
منفی    منفی    -    *    *    *    مرکزی    بومی    36    ماده    گوسفند    2
منفی    منفی    -    *    *    *    مرکزی    بومی    36    ماده    گوسفند    3
منفی    منفی    -    *    بیضه    *    مرکزی    بومی    24    نر    بز    4
منفی    مثبت    -    *    بیضه    *    مرکزی    بومی    8    نر    گوسفند    5
منفی    منفی    -    *    بیضه    *    همدان    بومی    8    نر    گوسفند    6
منفی    مثبت    دارد    *    *    *    همدان    بومی    24    ماده    گوسفند    7
منفی    منفی    -    *    *    *    همدان    بومی    36    ماده    گوسفند    8
منفی    منفی    -    *    *    *    همدان    بومی    24    ماده    بز    9
منفی    منفی    -    *    *    *    همدان    بومی    36    ماده    گوسفند    10
منفی    منفی    -    *    *    *    تکاب    کرد افشار    36    ماده    گوسفند    11
منفی    منفی    -    *    *    *    تکاب    کرد افشار    48    ماده    گوسفند    12
بروسلا ملی-تنسیس    مثبت
    دارد    *    *    *    تکاب    کرد افشار    48    ماده    گوسفند    13
منفی    منفی    -    *    *    *    تکاب    کردافشار    48    ماده    گوسفند    14
منفی    منفی    -    *    بیضه    *    تکاب    کردافشار    24    نر    بز    15
منفی    منفی    -    *    *    *    تکاب    کردافشار    60    ماده    بز    16
منفی    منفی    -    *    *    *    کرمانشاه    کردبومی    24    ماده    گوسفند    17
منفی    منفی    -    *    *    *    کرمانشاه    کردبومی    36    ماده    گوسفند    18
منفی    منفی    -    *    *    *    کرمانشاه    کردبومی    36    ماده    گوسفند    19
منفی    منفی    -    *    *    *    کرمانشاه    کردبومی    24    ماده    گوسفند    20
منفی    منفی    -    *    بیضه    *    کردستان    کردبومی    7    نر    بز    21
منفی    منفی    -    *    *    *    کردستان    کردبومی    12    ماده    بز    22
منفی    منفی    -    *    *    *    کردستان    کردبومی    12    ماده    بز    23
منفی    منفی    -    *    *    *    کردستان    کردبومی    12    ماده    بز    24
منفی    منفی    -    *    *    *    کردستان    کردبومی    12    ماده    بز    25
منفی    مثبت    -    *    *    *    لرستان    بومی    36    ماده    گوسفند    26
منفی    مثبت    -    *    *    *    لرستان    بومی    36    ماده    گوسفند    27
بروسلا ملی-تنسیس    مثبت    -    *    *    *    لرستان    بومی    36    ماده    گوسفند    28
منفی    مثبت    -    *    *    *    لرستان    بومی    36    ماده    گوسفند    29
    منفی    -    *    *    *    لرستان    بومی    36    ماده    گوسفند    30
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    31
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    32
بروسلا آبورتوس    مثبت    دارد    *    *    *    قم    دورگ    48    ماده    گاو    33
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    34
بروسلا ملی-تنسیس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    35
منفی    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    36
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    37
بروسلا آبورتوس    مثبت    دارد    *    *    *    قم    دورگ    48    ماده    گاو    38
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    39
بروسلا آبورتوس    مثبت    -    *    *    *    قم    دورگ    36    ماده    گاو    40
منفی    منفی    سالم    *    *    *    قم    دورگ    36    ماده    گاو    41
منفی    منفی    سالم    *    *    *    قم    دورگ    36    ماده    گاو    42
منفی    منفی    سالم    *    بیضه    *    قم    دورگ    24    نر    گاو    43
منفی    منفی    سالم    *    بیضه    *    قم    دورگ    24    نر    گاو    44

جدول 2. فراوانی و درصد فراوانی گاوهای مبتلا به بروسلوز بر اساس تست رزبنگال
    فراوانی    درصد    درصد تجمعی
تست رزبنگال مثبت    10    42/71    72/22
سالم    4    57/28    09/9
مجموع    14    100    81/31

جدول 3. فراوانی و درصد فراوانی گوسفندهای مبتلا به بروسلوز بر اساس تست رزبنگال
    فراوانی    درصد    درصد تجمعی
تست رزبنگال مثبت    7    33/33    90/15
سالم    14    66/66    81/31
مجموع    21    100    72/47

جدول 4. فراوانی و درصد فراوانی بزهای مبتلا به بروسلوز بر اساس تست رزبنگال
    فراوانی    درصد    درصد تجمعی
تست رزبنگال مثبت    0    0    0
سالم    9    100    45/20
مجموع    9    100    45/20


شناسایی مولکولی باکتری بروسلا در عقده¬های لنفی گاو و گوسفند به روش Real-time PCR از 44 نمونه مورد آزمایش 11 نمونه (37/20 درصد) با استفاده از روش Real-time PCR آلوده به باکتری بروسلا تشخیص داده شد. که سه نمونه آلوده به بروسلا ملی¬تنسیس (5/5 درصد) و هشت نمونه آلوده به بروسلا آبورتوس (81/14درصد) بودند. 
با توجه به نتایج شناسایی گونه¬های بروسلا به روش Real-time PCR که در جدول پنج و شکل یک امده است، از سه  نمونه مثبت مربوط به بروسلا ملی تنسیس دو نمونه مربوط به گوسفند و یک نمونه مربوط به گاو و از هشت نمونه مثبت بروسلا آبورتوس همگی مربوط به نمونه¬های اخذ شده از گاو بودند.
جدول 5. فراوانی و درصد آلودگی به بروسلا در نمونه های مورد آزمایش به روش Real-time PCR
نوع نمونه    تعداد کل نمونه ها آلوده به جنس بروسلا    شماره نمونه آلوده به باکتری بروسلا آبورتوس    شماره نمونه آلوده به باکتری بروسلا ملی تنسیس
گاو سالم    0    0    0
گاو رزبنگال مثبت    9
45/20 درصد    8
18/18 درصد    1
27/2 درصد
گوسفند سالم    0
    0    0

گوسفند رزبنگال مثبت    2
5/4 درصد    0    2
5/4 درصد
بز سالم    0    0        0
مجموع    11
25 درصد    8
18/18 درصد    3
81/6 درصد


 
شکل 1. درصد آلودگی کل نمونه¬ها به باکتری بروسلا
استخراج DNA  
در این تحقیق استخراجDNA   از نمونه های بافت لنفاوی با استفاده از کیت High Pure PCR Template Preparation Kit  ساخت شرکت  Rocheبا شماره ی کاتالوگ 11796828001مطابق دستورالعمل سازنده انجام شد
آغازگر¬¬های استفاده شده در این مطالعه از سه جفت پرایمر استفاده شد که به ترتیب مربوط به ژن IS711 اختصاصی جنس بروسلا و برای تشخیص گونه های B. melitensis و B. abortus به ترتیب متعلق به ژن BMEII0466  و ژن BruAb2_0168 می باشند و  مطابق روش V. Hinić  و همکاران می¬باشد (9). مشخصات پرایمرها و پراب مورد استفاده در جدول شش  آمده است.
جدول6. توالی پرایمرها و پراب مورد استفاده در این مطالعه
ژن هدف    نام پرایمر    توالی پرایمر و پراب (5→3)    اندازه محصول(جفت باز)
IS711    IS711-F    GCTTGAAGCTTGCGGACAGT    63 bp
    IS711-R    GGCCTACCGCTGCGAAT    
    IS711-probe    FAM-AAGCCAACACCCGGCCATTATGGT-TAMRA    
BMEII0466    BMEII0466-F    TCGCATCGGCAGTTTCAA    112 bp
    BMEII0466-R    CCAGCTTTTGGCCTTTTCC    
    BMEII0466-probe    Cy5-CCTCGGCATGGCCCGCAA-BHQ-2    
BruAb2_0168    BruAb2_0168-F    GCACACTCACCTTCCACAACAA    222 bp
    BruAb2_0168-R    CCCCGTTCTGCACCAGACT    
    BruAb2_0168-probe    FAM-TGGAACGACCTTTGCAGGCGAGATC-BHQ-1    

آماده سازی مسترمیکس و تهیه ی محصول PCR
برای شناسایی جنس و گونه¬های بروسلا، از کیت RealQ Plus 2x Master Mix for Probe شرکت Ampliqon به شماره کاتالوگ A313402 استفاده شد. ابتدا مواد مورد نیاز از فریزر 20- خارج و در دمای محیط و زیر لامینارفلو قرار داده شد تا به آرامی ذوب شوند. برای ساخت مسترمیکس، طبق دستورالعمل سازنده کیت به ازای هر نمونه (ژنوم استخراج شده از هر کد نمونه) مقدار25/5 میکرولیتر آب مقطر فاقد نوکلئاز، 5/12 میکرولیتر بافر 2X، یک میکرولیتر از هرکدام از پرایمرهایF  و R با غلظت µM 10و 25/0 میکرولیتر پراب با غلظت µM 10 (سنتز شده توسط شرکت سیناژن- ایران) تهیه شد. بعد از آماده شدن مسترمیکس، به تعداد نمونه¬های مورد آزمایش، میکروتیوپ¬های پی سی آر را در داخل کول باکس قرار داده و در هر میکروتیوپ 20 میکرولیتر مسترمیکس و پنج میکرولیتر از ژنوم مورد آزمایش ریخته شد و بعد از حدود پنج ثانیه سانتریفوژ، میکروتیوپ¬ها برای آزمایش Real-time PCR به دستگاه ترماسایکلر RotorGene Q (ساخت شرکت Qiagene، آلمان) انتقال داده شد. افزوده سازی به صورت واسرشته سازی اولیه (Initial denaturation ) در 95 درجه سانتی¬گراد به مدت 15 دقیقه و سپس 40 سیکل به ترتیب شامل واسرشته سازی 95 درجه به مدت 20 ثانیه، اتصال پرایمر (Annealing) 60 درجه 30 ثانیه و طویل سازی(Elongation) 72 درجه 20 ثانیه انجام شد.
نتـایج
در این مطالعه از 30 لاشه گوسفند و بز و 14 لاشه گاو نمونه بافت لنفاوی جمع آوری شد و تمامی نمونه ها با استفاده روش Real time PCR مورد بررسی قرار گرفتند. تعداد نمونه های بروسلا مثبت به تفکیک گونه به دست آمده در جدول 2 نشان داده شده است.
جدول2.  فراوانی و درصد آلودگی به بروسلا در آزمون Real-time PCR
نوع نمونه    تعداد کل نمونه ها آلوده به جنس بروسلا    تعداد نمونه آلوده به باکتری B. abortus    تعداد نمونه آلوده به باکتری B. melitensis
گاو    9
45/20  درصد    8
18/18  درصد    1
27/2  درصد
گوسفند    2
5/ درصد    0    2
5/4 درصد
بز    0    0    0
مجموع    11
25 درصد    8
18/18 درصد    3
81/6  درصد
نمودار تکثیر  Real time PCR برای نمونه¬ها
در این آزمایش برای صحت و درستی واکنش از DNA سویه واکسن RB51 (Razi institute, Iran) B. abortus و سویه واکسن Rev.1 (Razi institute, Iran) B. melitensis به عنوان دو کنترل مثبت استفاده گردید و برای کنترل منفی از آب مقطر استفاده شد. در ابتدا برای شناسایی جنس عمومی باکتری بروسلا از پرایمرهای جنس بروسلا استفاده گردید که در صورت مثبت شدن نتیجه Real-time PCR آن در مرحله بعدی، برای تعیین گونه بروسلا از پرایمرهای اختصاصی گونه B. abortus و B. melitensis استفاده شد. نتایج در شکل 2 نشان داده شده است.
  
شکل 2. نمودار تکثیر باکتری بروسلا برای ژن IS711 جنس عمومی بروسلا در 30 نمونه گوسفند و بز و 14 نمونه گاو
برای تعیین گونه های جنس بروسلا از نمونه‌های مثبت، مجددا آزمایش Real-time PCR به وسیله پرایمرهای گونه B. abortus و B. melitensis به طور جداگانه انجام پذیرفت. این آزمایش در دو گروه 13 تایی انجام شد. گروه اول شامل11 نمونه مثبت در مرحله جنس، کنترل منفی و DNA  باکتری B. abortus به عنوان کنترل مثبت، که در این گروه از پرایمرهای اختصاصی گونه B. abortus استفاده شد. گروه دوم نیز همانند گروه اول شامل 11 نمونه مثبت در مرحله جنس، کنترل منفی و یک کنترل مثبت شامل DNA  باکتری B. melitensis که در این گروه از پرایمرهای اختصاصی گونه B. melitensis در نمونه های مذکور استفاده شد و برنامه دمایی نیز همانند گروه قبلی بود. نتایج در شکل 3  نشان داده شده است. 
   
شکل 3. نمودار تکثیر برای تعیین گونه B. abortus و B. melitensis در نمونه های مثبت مورد آزمایش برای ژن BruAb2_0168 و BMEII0466
بحث 
تابلوی کلینیکی بروسلوزیس به جهت علائم غیراختصاصی و بعضا غیرمعمول، به تنهایی نمی¬تواند بیانگر این بیماری باشد. بنابراین تأیید تشخیص، به آزمون¬های آزمایشگاهی نیاز دارد. در حال حاضر بیشتر از روش¬های سرولوژیکی برای تشخیص بروسلوز استفاده می¬شود. سرولوژی روش مؤثرتری برای تشخیص است هرچند، واکنش متقاطع با سایر ارگانیسم¬ها بزرگترین مشکل آن است. تیترها برای دوره¬ی زمانی طولانی پس از درمان، مثبت باقی می¬مانند. حساسیت روش¬های سرولوژیکی 95 -65  درصد است اما اختصاصیت آن در مناطق اندمیک پایین است. برای رفع مشکلات ذکر شده در بالا و نیز دستیابی به متدهای ردیابی سریع پاتوژن و نیز تعیین دقیق گونه¬های بروسلا، تعیین اسیدهای نوکلئیک آن مد نظر قرار گرفت. علاوه بر این، روش Real-time PCR در مقایسه با PCR معمولی نتایج قابل اعتماد و قابل تکرار را ارائه می که نشان می دهد نیازی به تجزیه و تحلیل پس از PCR (الکتروفورز ژل، هیبریداسیون) ندارد و در مقایسه با روش معمول خطر آلودگی متقاطع محدودی دارد. با این حال Real-time PCR، گران¬تر از PCR معمولی است. بسیاری از مطالعات نشان داده¬اند که روش مرسوم برای تشخیص گونه¬های بروسلا از نظر فنی نسبت به روش Real-time PCR وقت گیرتر و سخت¬تر است (11و12).
در سال¬های اخیر، مطالعه¬ها و ارزیابی¬های متفاوتی راجع به حساسیت و اختصاصیت Real time PCR  در تشخیص بروسلوزیس در حیوانات صورت گرفته است. Bounaa dja و همکاران Real time PCR و PCR معمولی را با استفاده از ژن‌های یکسان مقایسه کردند. در تحقیقات آن¬ها، سه ژن از بروسلا شامل ژن‌های IS711، bcsp31 و per  با هر دو تکنیک مورد ارزیابی قرار گرفتند. نتیجه‌گیری شد که استفاده از روش‌های Real-time PCR آسان است و نتایج سریع‌تری نسبت به سیستم‌های P‏CR  معمولی ایجاد می‌کند و در عین حال خطر آلودگی DNA را کاهش می‌دهد (13). 
Surucuoglu و همکاران در سال 2009 مزایای استفاده از تکنیک Real-time PCR TaqMan را آزمایش و آن را با روش‌های مرسوم با استفاده از نمونه‌های سرم بیماران مبتلا به اشکال بالینی مختلف بروسلوزیس مقایسه کردند. این تحقیق حساسیت و ویژگی بالای روش Real-time PCR را نشان داد و آن را به عنوان ابزاری مفید برای تشخیص بروسلوز با تظاهرات بالینی متفاوت تایید کرد (14).
ثابت شده است زمانی که کشت منفی است و نتایج سرولوژی غامض، Real time PCR  روشی ارزشمند و قابل اعتماد برای تشخیص بروسلوزیس است (15).
هدف از این مطالعه توصیف روش Real-time PCR برای تشخیص گونه¬های بروسلا در عقده¬های لنفی گاو و گوسفند بود. در این مطالعه از میان 44 نمونه، تعداد 11 مورد آلوده به جنس بروسلا و تمامی دام¬هایی که مبتلا به بروسلوز بودند در آزمایش  Real time PCR با استفاده از پرایمر اختصاصی گونه B. melitensis سه مورد و هشت مورد B. abortus مثبت شدند. لذا شیوع B. melitensis نیز برابر 81/6 درصد و B. abortus 18/18 درصد گزارش می¬شود. بروز بالای بروسلوز در نمونه¬های لنفاوی در مطالعه حاضر احتمالاً نشان می¬دهد که این حیوانات در ارتباط نزدیک با گوسفند و گاو آلوده نگه¬داری می¬شدند. در تحقیق دوستی و قاسمی¬ده¬کردی در سال 1390 از 452 نمونه سرم گاوی که به روش Real Time PCR  انجام گرفت، برای افتراق گونه¬های B. abortus و B. melitensis از 127 نمونه سرم گاوی مثبت در PCR ،نه مورد به B. melitensis ،69 مورد به B. abortus و پنج  نمونه به هر دو گونه آلوده بودند (16). این یافته¬ها بالاتر از نتایج بدست آمده در این تحقیق است. 
در مطالعه خامسی¬¬پور و همکاران در سال 2015 که با هدف شناسایی بروسلا در نمونه¬های خون و غدد لنفاوی شتر با استفاده از روش Real-time PCR در ایران طراحی شد، PCR Real time برای تمایز گونه‌ها و بر اساس جایگاه‌های ژنتیکی، ژن BMEII0466 برای B. melitensis و ژن Bru-Ab2_0168 برای B. abortus استفاده شد که مشابه ژن¬های هدف مورد استفاده در این تحقیق می¬باشد. در مطالعه فوق Brucella spp. در 18 نمونه خون (33/13درصد) و چهار نمونه (97/2درصد) غدد لنفاوی شناسایی شد. این روش به ترتیب در تشخیص B. abortus و B. melitensis در نمونه‌های خون و لنف مؤثر بود. B. abortus در سه نمونه خون (22/2درصد) مشاهده شد اما در نمونه های غدد لنفاوی مشاهده نشد. B. melitensis تنها در چهار  نمونه (97/2درصد) غدد لنفاوی مشاهده شد (17).
در مطالعه¬ای که توسط Seo´nadh O’ Leary و همکاران در سال 2006 انجام شد شناسایی B. abortus در نمونه¬های شیر، خون و غدد لنفاوی گاوهای آلوده با استفاده از روش Real-time PCR با استفاده از جایگاه‌های ژنتیکی 16S rRNA و ژن IS711.  انجام شد، که مشابه ژن¬ هدف مورد استفاده در این تحقیق می¬باشد. B. abortus در نمونه¬های خون جمع¬آوری شده از گاوهای آلوده به طور طبیعی توسط PCR معمولی یا Real-Time تشخیص داده نشد، اما در شیر (44درصد) و بافت لنفاوی (66درصد  رتروفارنکس و 75درصد فوق پستانی) شناسایی شد (18).
این مطالعه نشان داد که هر دو B. abortus و B. melitensis می‌توانند گاو را آلوده کنند، اما میزان بروز B. abortus بیشتر از B. melitensis بود. در نتیجه، شیوع بروسلوز در گاو و گوسفند به میزان آلودگی میزبان¬های اولیه در تماس با آنها بستگی دارد. از سوی دیگر، گسترش بروسلوز در گاوها به شیوع گونه¬های بروسلا در سایر حیواناتی که محل نگه¬داری آن¬ها مشترک بوده و به روش¬های پرورش گونه¬های مختلف بستگی دارد.
در واقع مرحله آلودگی دام¬ها در این آزمایش مشخص نبود. از این¬رو، بعید است که حیوانات هنگام نمونه¬برداری در مراحل اولیه عفونت بوده باشند. این احتمال وجود دارد که برخی از حیوانات ممکن است باکتری را قبل از نمونه¬برداری دفع کرده باشند. از این رو، مرحله عفونت که در آن نمونه جمع‌آوری می‌شود، می‌تواند تأثیر عمده‌ای بر تشخیص باکتری با استفاده از PCR داشته باشد.
نتیجه‌گیری کلـی و پیشنهادها
این مطالعه نشان داد که روش Real-time PCR روشی حساس‌، اختصاصی‌ و سریع‌ است و علاوه بر تشخیص بروسلوزیس، قادر به افتراق بین B.abortus و B. melitensis می¬باشد. علاوه بر این، با روش¬های ایمونولوژیک، برهمکنش¬های آنتی-بادی-آنتی¬ژن می¬تواند توسط فعل و انفعالات غیراختصاصی دشوار باشد و نتایج مثبت کاذب از حیوانات واکسینه شده با سطوح بالای آنتی¬بادی در گردش مشاهده شود.
نتایج ما نشان می دهد که باکتری ممکن است به راحتی در بافت لنفاوی قابل تشخیص باشد. تشخیص PCR در نمونه‌های بافت گاو و گوسفندهای آلوده به‌طور طبیعی قبلاً نشان داده شده است. در نتیجه¬گیری اینکه نمونه¬های بافتی از غدد لنفاوی امیدوارکننده¬ترین نوع نمونه برای تشخیص بروسلا توسط PCR به نظر می¬رسد، توجه به این نکته مهم است که نمونه¬های لنفاوی پس از مرگ جمع¬آوری شدند. این به دور از یک موقعیت ایده¬آل برای یک آزمایش تشخیصی است. با توجه به این مشاهدات، ما پیشنهاد می‌کنیم که استفاده از نمونه‌های بیوپسی از بافت لنفاوی برای تشخیص بروسلا ارزش بررسی داشته باشد.
تقـدیر و تشـکر 
از تمامی کسانی که در جمع‌آوری نمونه همکاری کردند سپاسگزاریم.
تعارض منافع 
هیچ¬گونه تضاد منافعی بین نویسندگان وجود ندارد و این مقاله با اطلاع و هماهنگی آنها ارسال شده است.
 
مرور کتاب: پژوهشی اصیل | موضوع مقاله: بهداشت مواد غذایی
دریافت: 1402/2/25 | پذیرش: 1402/3/8 | انتشار: 1402/8/26

فهرست منابع
1. Christopher, S., et al. (2010). "Brucellosis: Review on the Recent Trends in Pathogenicity and Laboratory Diagnosis." J Lab Physicians 2(02): 055-060. [DOI:10.4103/0974-2727.72149] [PMID] [PMCID]
2. Padilla Poester, F., et al. (2010). "Diagnosis of brucellosis." The Open Veterinary Science Journal [DOI:10.2174/1874318801004010046]
3. Bentham Open. https://doi.org/10.2174/1874318801004010046 [DOI:10.2174/1874318801004010046.]
4. Megid, J., et al. (2010). Clinical manifestations of brucellosis in domestic animals and humans, Bentham Open. [DOI:10.2174/1874318801004010119]
5. Khamesipour, F. and Momeni M. (2014). "Brucella abortus and Brucella melitensis in Iranian bovine and buffalo semen samples: The first clinical trial on seasonal, Senile and geographical distribution using culture, conventional and real-time polymerase chain reaction assays." Kafkas Üniversitesi Veteriner Fakültesi Dergisi. [In Persian]
6. Garshasbi, M., et al. (2014). "Molecular detection of Brucella species in patients suspicious of Brucellosis from Zanjan, Iran." Brazilian Journal of Microbiology 45: 533-538. [DOI:10.1590/S1517-83822014005000048] [PMID] [PMCID]
7. Kovacova, D., et al. (2007). "Importance of serological diagnostics in ovine epididymitis caused by Brucella ovis." Bulletin of the Veterinary Institute in Puławy 2(51).
8. Mitka, S., et al. (2007). "Evaluation of different PCR assays for early detection of acute and relapsing brucellosis in humans in comparison with conventional methods." Journal of clinical microbiology 45(4): 1211-1218. [DOI:10.1128/JCM.00010-06] [PMID] [PMCID]
9. Espy, M., et al. (2006). "Real-time PCR in clinical microbiology: applications for routine laboratory testing." Clinical microbiology reviews 19(1): 165-256. [DOI:10.1128/CMR.19.1.165-256.2006] [PMID] [PMCID]
10. Taleski, V., et al. (2002). "An overview of the epidemiology and epizootology of brucellosis in selected countries of Central and Southeast Europe." Veterinary microbiology 90(1-4): 147-155. X [DOI:10.1016/S0378-1135(02)00250-] [PMID]
11. Hinić, V., et al. (2008). "Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems." Journal of Microbiological Methods 75(2): 375-378. https://doi.org/10.1016/j.mimet.2008.07.002 [DOI:10.1016/j.mimet.2008.07.002.] [PMID]
12. Bogdanovich, T., et al. (2004). "Validated 5′ nuclease PCR assay for rapid identification of the genus Brucella." Journal of clinical microbiology 42(5): 2261-2263. [DOI:10.1128/JCM.42.5.2261-2263.2004] [PMID] [PMCID]
13. Yang, S.-J., et al. (2007). "Bacteriological detection of Brucella abortus and its characterization by PCR in the sporadic outbreak of bovine brucellosis in Gyeonggi province." Korean Journal of Veterinary Service 30(2): 251-258.
14. Bounaadja, L., et al. (2009). "Real-time PCR for identification of Brucella spp.: A comparative study of IS711, bcsp31 and per target genes." Veterinary microbiology 137(1): 156-164. [DOI:10.1016/j.vetmic.2008.12.023] [PMID]
15. Surucuoglu, S., et al. (2009). "Evaluation of real-time PCR method for rapid diagnosis of brucellosis with different clinical manifestations." Polish journal of microbiology 58(1): 15.
16. Al Dahouk, S., et al. (2007). "Evaluation of genus-specific and species-specific real-time PCR assays for the identification of Brucella spp. https://doi.org/10.1515/CCLM.2007.305 [DOI:10.1515/CCLM.2007.305.] [PMID]
17. Doosti, A. and P. Ghasemi Dehkordi (2011). "Application of real-time PCR for identification and differentiation of Brucella abortus and Brucella melitensis in cattle." Bulgarian Journal of Veterinary Medicine 14(2): 109-115.
18. Khamesipour, F., et al. (2015). "Molecular study of Brucellosis in camels by the use of TaqMan® real-time PCR." Acta Microbiologica et Immunologica Hungarica 62(4): 409-421. https://doi.org/10.1556/030.62.2015.4.6 [DOI:10.1556/030.62.2015.4.6. [In Persian].] [PMID]
19. O'Leary, S., et al. (2006). "Brucella abortus detection by PCR assay in blood, milk and lymph tissue of serologically positive cows." Research in Veterinary Science 81(2): 170-176. 1 [DOI:10.1016/j.rvsc.2005.12.00] [PMID]

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب‌سایت متعلق به مجله بیماری های قابل انتقال بین انسان و حیوان است.

طراحی و برنامه نویسی: یکتاوب افزار شرق

© 2024 All Rights Reserved | Journal of Zoonosis

Designed & Developed by: Yektaweb